 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| circ-102004 | |||
| Gene | n/a | Organism | Human |
| Genome Locus | n/a | Build | hg19 |
| Disease | Prostate Cancer | ICD-10 | Malignant neoplasm of prostate (C61) |
| DBLink | Link to database | PMID | 30219508 |
| Experimental Method | |||
| Sample Type | Tissues and Cell lines | Comparison | 16 PCa tissues and 6 benign prostatic hyperplasia tissues were collected from patients |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward AAACGATTTGAACACTCAGCCA ReverseTGTTGGCCTTCTTCCCATTGT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Si-Tu, J, Cai, Y, Feng, T, Yang, D, Yuan, S, Yang, X, He, S, Li, Z, Wang, Y, Tang, Y, Ye, C, Li, Z (2019). Upregulated circular RNA circ-102004 that promotes cell proliferation in prostate cancer. Int. J. Biol. Macromol., 122:1235-1243. | |||